1. Assemble the fragments
2. How many potential reading frames are there?
3. Give the names of these genes?
4. The identity and similarity of the last gene with H. sapiens?
    - nucleotide and amino acid sequence
5. MW, pI and potential post-translational modification sites of any ONE protein.


>02
aagaattcaatcaaaaaatttcaaataaaaatatgatattttcaaaatatagtactttcatattgaatta
taagaaaaatgactggaaaataactgcagacatttatctttttaagaaaacaaacactatgcctacaaat
aagattatcatattttattttgtgataaaaattgatttttcaagtaagaaaagagattaaaatattttta
gttggatttgtttgaatgttattatatatatatactttaagggcgggctccacaagctagaacggacttg
ccactcaaaatcattgaaataatgaatccgtaaagacctaaaacttctccgaaaatcaaaataagcatag
cacccatgaaaagttctggatgagagctcatagcgcgacatgaaacatcaccagcaattccgatagcgca
gcctgatgctaaaccagcaagaccgacacaaagaccaccactgaagatagcgtatgatttgaattgtgag
aatggatagtgaatatttgttgatgaaataattgcagcgactaaaccgta

>01
tgtctagagaccataattttgggatttatattaatttcatatggagatattatttctactatgtgcacat
aataataaaaagaaataatattgtaaattgtcaaattttctggtttacattgtcaaaagtttgagtttac
aaatgtcagttctgatggaactccaaatggtgaaattgattgagtcaagtctttttattttaaaataggc
ttggtatattttaatagcatcccagcaattggaactttttaatcgtcatgacgatcaggtcttgaaaatt
aaaaggccattttgtaaacttcataaagctgaatgtctgcaacttactcacccgaacagcaatttaacga
cccatattgcccaccaacatcagttgctctcggatatgtcggaattgcctgcgctctttctttcacatca
ttaggaagtgcttatggcacattcaaatctgccatcggcttgttcaaggtctgctctgagcatccagaac
tcttctaccgttctatgatgccagtcattatggccggtattgtcggtatctacggtttagtcgctgcaat
tatttcatcaacaaatattcactatccattctcacaattc

>03
atcaaacaataacataatcgatatttcagaatttgctttgccatgaggggaattataacataattcactt
gagcctatattaagtataagtcaataaagacgatatcaatctttgatatgagtaacaacaaattatctaa
taatttgcaactgtacatcggcacttcgttcgaaatttaaagaattcaatcaaaaaatttcaaataaaaa
tatgatattttcaaaatatagtactttcatattgaattataagaaaaatgactggaaaataactgcagac
atttatctttttaagaaaa

>04
aagattagtaaacataatataaataagtttattgttgaggtctttattaaaataaaaactggcggttatt
ttttctcttgctttttcataaaaataaaaatggaaaatcaaatcgcctctatttcaaagaattaaaatca
gatacagcaccacttccaagatatgataatgaaaatcaaaaaccaattggacgagaaatagcaattaatt
caaaacgtatttattcggatcattcaacttagttatgcatagttaaaattaattatgagaaaatttccct
aaaattatgaatttttcaaaattatcaattgtctgcacctgctgcaatacgtctacagcatgaactagtt
taggatattg

>05
aaaaatcaatttttatcacaaaataaaatatgataatcttatttgtaggcatagtgtttgttttcttaaa
aagataaatgtctgcagttattttccagtcatttttcttataattcaatatgaaagtactatattttgaa
aatatcatatttttatttgaaattttttgattgaattctttaaatttcgaacgaagtgccgatgtacagt
tgcaaattattagataatttgttgttactcatatcaaagattgatatcgtctttattgacttatacttaa
tataggctcaagtgaattatgttataattcccctcatggcaaagcaaattctgaaatatcgattatgtta
ttgtttgattgactttcaatgattagccgaaaccatcgaagtgatttatactaatttgataagtcaaatg
caatatcctaaactagttcatgctgtagacgtattgcagcaggtgcagacaattgataattttgaaaaat
tcataattttagggaaattttctcataattaattttaactatgcataactaagttgaatgatccgaataa
atacgttttgaattaattgctatttctcgtccaattggtttttgattttcattatcatatcttggaagtg
gtgctgtatctgattttaattctttgaaat

>06
tcccgcgttttctaccagaagctcaaggctgactactaccgctacatctgcgaatcccgctctgatgatg
agaagacagaaccagcccagaaggctaaggaatgctacgaagctgctatgcagatttccaacgctgaaat
cgctcagtaccgcccaacatcactcggcctcatccttaactactctgtcttcctttatgagatcatcggc
gaaaagcaaaaggccatcgatcttgctcagaagacatacaatacatgctcatccaatgttgagaagaact
cagataactcatactctgaggcaacaatgatccttcaactccttcgtgataacgttcaactctggacaca
ggacaacgagtaaattatgatttaattgctcaatgtaatattaaggattttttttatattcgaccaattt
tctttacataaattgtaaactgtgtgatctcaaattttttacgatgcgaaattttgtttcgtattttgga
tttggtatcaaataggtattcctattttcaaatgaaaacgaaaatcggcttgatgggaggtttatgttgt
aaagattttttttcaattgatgccaacaacaaaagtttgtattggtgattctaagtataataggagccgg
agaacttgtctgcaattagttcatgttgaagttctcgggatgtcatacaaatgtggaagttaatccagaa
agcattagcataagctaatgctcctgtgatactgtgattctatgtttgtcagagtatgatgaaaaagaca
ggagattgcatctaaatagaatatttatattagaaaattttcaaaataagatcatatcatccatatatgg
ttcccattgattctatttattctatatatttgaaattttgccgcagggaagtatcaggaatgtacttttg
acatgattgcatcatgcacgttattttgatgaaagctcgtaaaatttaaataagaattttatttgttttt
agtgatttcactcagtcaaatcaaaaaaatttttgaataccactcaatttttctttgatggataagacag
gttttattttctaactgaatcaggatggaa

>07
aagttgaatgatccgaataaatacgttttgaattaattgctatttctcgtccaattggtttttgattttc
attatcatatcttggaagtggtgctgtatctgattttaattctttgaaatagaggcgatttgattttcca
tttttatttttatgaaaaagcaagagaaaaaataaccgccagtttttattttaataaagacctcaacaat
aaacttatttatattatgtttactaatcttaaaacagtttataatttctaatttgaaagaaatttggcgt
tttgaatagttacgaccacttcacatctaatgtcgaacgaacgcgacgttgctttgttcatggctcaaat
ctatgaccagactgaccgccatcaggatatggtcgacacaatgaagaaggttattgagctttctgctgat
cttacaaacgatgagcgcaacctcctttctgttgcatacaagaacatcatcggatcccgccgtaatggtc
tccgcatgatcgccgctatcctcgagcatgaagatggccgtggcaacacacagcgcgttgcctccctcaa
cgcctatcgcaaggttatccttggcgaacttgagaagtactgcaacgagcttatcggcctcgtcgatctt
tcccttctcccagctgccaagacagctgaatcccgcgttttctaccagaagctcaaggctgactactacc
gctacatctgcgaatcccgctctgatgatgagaagacagaaccagcccagaaggctaaggaatgctacga
agctgctatg

>09
cttattgaaatcgctttccttttcatcgaaataaacatattcactcgctgaatatttcgttatatctgca
tcatgaagtgttttgatgatttctaatgatttccttttgattgcataactcaaagctgttaacgaagcat
tattacattcatctacattgctgcaaatgcttatcattcttgaaacaatttctggtgaacaatattggca
agcaagcattaaaggagtttcattttctatttctgttttgatggaaatatcacacttgcgatcaagaatc
ttatttacaaggatatcacttcctttcttaattgctatgacaattaaagattcatgcacatagtttggag
atccataatatcttttagtatatggtactaatattggtggacatatctttggatcggcgccattttctaa
tagaatattaactaattcaaagttatttgattgaaatgcataattaagagcagtaaatccttctttattt
ttggaattaatattatgacattgttcgacaatgtttgtaatggtttgttcggcatttatttcaattgtct
tggacttattaatggtcttcaatgccaatattaaaggagtatttccatcagaatcgatttcttcgaaatc
ttcgtaattatcacttattaaatttattgtttcaacactgaaatttttgaaaatagaacaaagcggtttt
ggatatcgtaaagacttttgaagtatatctattccatgcaaaataagaaattgcattacttcatcagatc
cagaattaataccatagtcaagcaaagtcataccattatattcaatatcatttgaaatttgatatcctat

>08
ttcccattgattctatttattctatatatttgaaattttgccgcagggaagtatcaggaatgtacttttg
acatgattgcatcatgcacgttattttgatgaaagctcgtaaaatttaaataagaattttatttgttttt
agtgatttcactcagtcaaatcaaaaaaatttttgaataccactcaatttttctttgatggataagacag
gttttattttctaactgaatcaggatggaactagccattccacagatatcatgctgtgagattcctagtt
tccttcgagattttgaagaattggcagcaatatctctttgccacgacgattttgaacaaaattcggagaa
atttcgtaaactacttgataaaataaatccagatggttactggtctattctaattgaaaagttttacaaa
agaataatgaaaagaaacttaagctttttcaattttttgaattttaattcagctaataaaacaaccaatt
cgtcaataagaaaagatgttcgtagaagtactgaaagagattttgacttcaatgatgatagagaacttag
tttaagcgaaaaattggctcatttcattgaaaatgatgataatgattcgtttaaagcagaatttgaagaa
cgtgtacctaaagagaataatggaagcttcaatttccttgttgatctaacagttcttaaagaaaatatgg
aactttttagatatctattaatgaatgggttaaaaccaacagaaaaagcgtgtaaattagcagtaatctc
tggaaatcttgatatcattagtattcttaatgagttagagttttcttttactccttatttgacaactgca
attaaatatcatcacaatgaaattgctgattggataatttcgaattcaacaaaaataaatatcagcagtc
tcatatgcttgaaatgtttcaatgttagagcatatacattttgtataatgaacaatattgatgattcttt
tggttatttactgaaaaacaaattattcaaaattgcagattttgcaatagaaaaagggcttaaaattgat
caatactatgaaaaatgtcttcgatttgattacttaaaaggcatagaatactttattaaaaatcacaaac
catctaatgaaagtattgctgatcttgttgaaagaggaaaatttgatattatcaaatacttgatgaataa
tgaggaaattagaaatgaaaagaatctaaaaatcatgatgacaaaggcaatgcagattcaatctattgat
atgatgaagttgttattagagtattcatatgattttgaagttaattctttattgttcaaagcgattgatt
ataacgtttcaaatgaaatcattgacctattgatttataattcatataaaagtgtattacacgagaaaga
aaacaacaaattgatgaaatatgctattgaaaaaggaaatagttatattgttgaatatctctatttgaat
ggagttccaatacaaaccaaagatagaaagcctcctgttatatatgcaattgaagcgaaatcagggaaat
tgactgaatttctttcaattataggatatcaaatttcaaatgatattgaatataatggtatgactttgct
tgactatggtattaattctggatctgatgaagtaatgcaatttcttattttgcatggaatagatatactt

>10
acgaaatattcagcgagtgaatatgtttatttcgatgaaaaggaaagcgatttcaataagttcattaaga
tctatgtttcagatcaatcaagagctaggtttacaacggcaatacaacaaattgtaaatgttaaacaatt
taccattaaaaaagagaataacattgtagatgtaatagaagagaacatttccaagccattacaaagtttg
attgatgcatcccagcgattaataccaaaagaaactttaagacggaaaaagaaaaaaccaagcgatgaga
tggcaagcaaagaacgtccacaaggaggtcctatcaaaaaagttataagaaggaaatattatgaagattc
tgatggtgatagttttgttgatttattttaatttagtattatctttcttaaattgccgaatttttgttaa
aattataaacgattatatctattatattaatgtatttattttcatccttaaattaaaaagaataactcta
tatttaatctaatataactcagataaatagatgatacgtaaataacaataccctgagctttaacaatcct
atcaattgattcatgatagtttttggtaattcaattacttaatttgattccgataaaaattatctaagga
taagttcaaacgattctgagagaaatatatagcgttcaatattgtatgcatgaattcatgataaattgag
aaatagttacgtacatgttgtaatttcatccgattattgagcgttccaatcaaatatttgataaaaatat
cgggaaaatagcatagatcccagtataaaaatagaaaaccaaagatagaattctttcaatgcgaatacga
atatgatttgaaacaatgaatagaccaatcataccattttctacatgaaatagttagtcttccagtagtt
aaacattcttaactagttatttcggctatcaaaaaagactagcaaaacagcgaatgaaacgacgatccaa
agtggccattttctacagaatatattagttctagcataag

>12
ccatccttctgaagaaggttagcaccagcgagtgaaccattgccaccgacaacgatgagaccgtcgatag
agaatctgtttaatgttctgatagcttctcttctgacctttggttccttccatgatggaagacgagctgt
accaatgaatgtaccaccaaggccgagttttcctgagacacttctggagttaagttcgaaaatctttcca
tcaactaaaccgaggtaacctctgttgatgccgtagaccttaagacctttctcgatgccatagcgtgtag
ctgatctgacaattgcattgagacctgcactatcaccacctgatgttaagataccgatagacttcatcta
caaaaataaaaaagaccagtttattattcaaaattttctgaagaatttgaatatgattaaaaatcaaagc
agaaaagacgatcacaaaatgatactttattttaatatgatattaaatactttacatcggcatttttaac
acattccatcatacgaaaattttgacatcaattttaggttttttatccatcaaattac

>11
cgaatgaaacgacgatccaaagtggccattttctacagaatatattagttctagcataagccaaaaagaa
tgcgtattaaattaagcaaatagcgaataacgatctcaaaagatgattcgaattgaatttgaaaatttat
taacttttatttagatctatatattgttggtgttatccatcttggcggttagagtcaatgaaaaattaaa
aatttgaaagcgtcttcgatgttagtcctctcaattttggatatttcccaaccaagtatacgacaagaat
ctttaaatgagcctaataatatttttgatcgacctattaaattgaatgaataaacgatgtgtaataaatt
ttgttgaagagtatcattatttaagtttattttgcatattatttcactaaaaacaacaaatttaaaaatt
gaaataaacattcgaggtaatcgatcttttttgattgaattgtcttttataagtaatttgatggataaaa
aacctaaaattgatgtcaaaattttcgtatgatggaatgtgttaaaaatg

>14
attgaatttaatttcttgtccatataattcgagttggatatcgtagtgcacgcttcaagcgctgctttaa
agctgccaaattcgagaaatatgtatccatcacaaattgatcgagaattattaggccatttgaatgaaat
agggtttacaagagttttaaaaaacgagagagttgattcgtatcgtgctgcaaagtttaaatttgttact
aaaacccatttattctgtcccatttttaaataacgattattttcaattcaaatgtaaataataaggactt
tttttgtcgaactgcgcttttgcacggttacctagcaggatgattttatagcttgagaattattatataa
ttgttttatattttagcaggtggggcgctgaagagttgtggattttttttttggaagcaacttgtgcaga
ttaaaatctagagaatcagagacagactaatatgcgacaaattgatggtaacatcgcagatgcgcatatc
ggggcagactagtgacttttataataatctgaattcccatttttcgaatcaagcattcatttatacttaa
cgatgaaatttacaactataaaaatcttattcaaatacctacagttatgaatactttataggtaaatttt
gaaatgcaaagtaagaaattaaaattagaaaataacaatgccctaagctaagtaaatactctcctgataa
gtatttaaatttttcgttgcaaatttttattcaaattaaaatatttcttataatttgtactttattagca
tatttaaaaagaaaattatttgggagagattgagaagaatgagtttagtttaaataattaagtttgacag
aaaatttttgcttattgttcgagttgtttgtataatttgtaaagatcctcgttaagtggcttaagctttc
caacgagatcctcgaatgggacaaggttg

>13
ggcaatggttcactcgctggtgctaaccttcttcagaaggatggtttcccagtcattggcctcccaggat
caatcgatgacgatgtttatggcactgacgtttgcattggtgtcgatacagccctcaacatcatcattga
ggctatcgagagaattcgtgattgcgcttcttccattcaacgtgctttcgtcgttgaagttatgggccgt
gattcaggtgctcttgccctcatggctgccgctgccgctggtgctgaagtctgcctcgtcccagaaggca
agaacccatcaatggaagaaatcgcaaagacaattactcaggcatatactcgtggtaagccacacgccat
cattgtcgtcgccgaaggctggaagccaggcacaaaggccctcatcgactaccttaagtcaattgaagac
cagacaggcttcgatgtcagaacaacagtcttaggttacacacagcgtggtggtgctccatcatatcgcg
accgttactacggcacaatcatgggtatggccgctgtcgacgctctccttgctggtgaatctggcaagat
ggttggcatcaaggacgaaaaggtcaaccttgtcccattcgaggatctcgttggaaagcttaagccactt
aacgaggatcttta
















 


創作者介紹
創作者 hshinyi 的頭像
hshinyi

算了

hshinyi 發表在 痞客邦 留言(0) 人氣()